Review



strain 33342  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 91
      Buy from Supplier

    Structured Review

    ATCC strain 33342
    Strain 33342, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rhinovirus+strain+17/Human+rhinovirus+17%3B+Strain%3A+33342/us12372525-385-48-50
    Average 91 stars, based on 3 article reviews
    strain 33342 - by Bioz Stars, 2026-10
    91/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Real-time loop-mediated isothermal amplification assay for rapid detection of human papillomavirus 16 in oral squamous cell carcinoma.
    Article Snippet: Objective: The present study established a real-time loop-mediated isothermal amplification (qLAMP) for rapid detection of human papillomavirus subtype 16 (HPV-16) in oral squamous cell carcinoma (OSCC).. Methods: The qLAMP assay was optimized targeting the HPV-16 E7 gene.. The analytical sensitivity and specificity of the assay were determined using HPV-18 (ATCC® 45152DTM), HPV-35 (ATCC® 40330TM), HPV-43 (ATCC® 40338TM) and HPV-56 (ATCC® 40549TM) viral strains and oral bacteria.



    Similar Products

    strain 33342  (ATCC)
    91
    ATCC strain 33342
    Strain 33342, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rhinovirus+strain+17/Human+rhinovirus+17%3B+Strain%3A+33342/us12372525-385-48-50
    Average 91 stars, based on 1 article reviews
    strain 33342 - by Bioz Stars, 2026-10
    91/100 stars
    		  Buy from Supplier
    genomic rna from human rhinovirus 17 strain 33 342  (ATCC)
    93
    ATCC genomic rna from human rhinovirus 17 strain 33 342
    List of commercially available molecular standards (nucleic acid solutions) used in analysis of the specificity of the three studied RT-qPCR assays.
    Genomic Rna From Human Rhinovirus 17 Strain 33 342, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rhinovirus+strain+17/Human+rhinovirus+17/pmc10144901-1-0-9
    Average 93 stars, based on 1 article reviews
    genomic rna from human rhinovirus 17 strain 33 342 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    vr 1663d  (ATCC)
    99
    ATCC vr 1663d
    HEV and HRV target sequences
    Vr 1663d, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rhinovirus+strain+17/Genomic+RNA+from+Human+rhinovirus+17+strain+33342/pmc06994036-25-3-2
    Average 99 stars, based on 1 article reviews
    vr 1663d - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    human rhinovirus strain 17  (ATCC)
    99
    ATCC human rhinovirus strain 17
    HEV and HRV target sequences
    Human Rhinovirus Strain 17, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rhinovirus+strain+17/Genomic+RNA+from+Human+rhinovirus+17+strain+33342/pm33581498-48-29-33
    Average 99 stars, based on 1 article reviews
    human rhinovirus strain 17 - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    rhinovirus  (ATCC)
    99
    ATCC rhinovirus
    HEV and HRV target sequences
    Rhinovirus, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rhinovirus+strain+17/Genomic+RNA+from+Human+rhinovirus+17+strain+33342/pmc07444299__NIHPP2020__08__17__20177006___supplement___1-13-39-40
    Average 99 stars, based on 1 article reviews
    rhinovirus - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain  (ATCC)
    99
    ATCC ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain
    HEV and HRV target sequences
    Ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg Target Hrv F Atcc Vr 1663d Commercial Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rhinovirus+strain+17/Genomic+RNA+from+Human+rhinovirus+17+strain+33342/pm32161799-168-117-119
    Average 99 stars, based on 1 article reviews
    ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    atcc vr 1663d  (ATCC)
    99
    ATCC atcc vr 1663d
    HEV and HRV target sequences
    Atcc Vr 1663d, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rhinovirus+strain+17/Genomic+RNA+from+Human+rhinovirus+17+strain+33342/pmc06994036-25-2-2
    Average 99 stars, based on 1 article reviews
    atcc vr 1663d - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    vr-1663d  (atcc)
    99
    atcc vr-1663d
    HEV and HRV target sequences
    Vr 1663d, supplied by atcc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rhinovirus+strain+17/Genomic+RNA+from+Human+rhinovirus+17+strain+33342/pmc06994036-25-0-2
    Average 99 stars, based on 1 article reviews
    vr-1663d - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    List of commercially available molecular standards (nucleic acid solutions) used in analysis of the specificity of the three studied RT-qPCR assays.

    Journal: Scientific Reports

    Article Title: Commercially available SARS-CoV-2 RT-qPCR diagnostic tests need obligatory internal validation

    doi: 10.1038/s41598-023-34220-w

    Figure Lengend Snippet: List of commercially available molecular standards (nucleic acid solutions) used in analysis of the specificity of the three studied RT-qPCR assays.

    Article Snippet: Genomic RNA from Human rhinovirus 17 strain 33,342 , ATCC-VR-1663D.

    Techniques: Virus

    HEV and HRV target sequences

    Journal: Biology Methods & Protocols

    Article Title: An array-based melt curve analysis method for the identification and classification of closely related pathogen strains

    doi: 10.1093/biomethods/bpy005

    Figure Lengend Snippet: HEV and HRV target sequences

    Article Snippet: Target-HRV-F , ATCC: VR-1663D , Commercial strain , na.

    Techniques: Amplification, Sequencing, Binding Assay

    HEV and HRV target sequences

    Journal: Biology Methods & Protocols

    Article Title: An array-based melt curve analysis method for the identification and classification of closely related pathogen strains

    doi: 10.1093/biomethods/bpy005

    Figure Lengend Snippet: HEV and HRV target sequences

    Article Snippet: Target-HRV-F , ATCC: VR-1663D , Commercial strain , na.

    Techniques: Amplification, Sequencing, Binding Assay

    HEV and HRV target sequences

    Journal: Biology Methods & Protocols

    Article Title: An array-based melt curve analysis method for the identification and classification of closely related pathogen strains

    doi: 10.1093/biomethods/bpy005

    Figure Lengend Snippet: HEV and HRV target sequences

    Article Snippet: Target-HRV-F , ATCC: VR-1663D , Commercial strain , na.

    Techniques: Amplification, Sequencing, Binding Assay